Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10708C1
Clone ID IST10708C1
Vector VICTR76
Project tigm

Sequence tag IST10708C1BBF1
Sequence
GCTCTAGTTTTATGTTCCTTCCACCCTTATCCCACACCCTTAAAATCCATTCCCNCNCNTATTNACCAGGTTTCTGCTTG
AATGAATTAGCAAACTCATTAAGCTCCTTAGTAGTGTAGCGAATTTCCTCATGGACTATACTTTNTACCTCCNNTNTNGG
AGCCTGTTTTGCTTTGAGTCTGGNNACNGGTNTAGAAGAAACTATTGGTGGGCCGTGAGCANACTNTGNNNNATTAATTT
CCTNNTGTGGGGAAGGCATTATTTCAAGAGGTGGGGCTGAGGGTACTACTTCCTCAGGTGGGGCAAACCCTTGAGAATCT
GAGGATTCAAAATTCTCAGCTTCNACATGGTCTTCCCACACNTNCNNGTCCNATGTNGNAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10708C1HMF2
Sequence
GCTCTAGTTTTATGTTCCTTCCACCCTTATCCCACACCCTTAAAATCCATTCCCACACATATTCACCAGGTTTCTGCTTG
AATGAATTAGCAAACTCATTAAGCTCCTTAGTAGTGTAGCGAATTTCCTCATGGACTATACTTTCTACCTCCCCTCTAGG
AGCCTGTTTTGCTTTGAGTCTGGTTACAGGTCTANAAGAAACTATTGGTGGGCCGTGAGCANACTCTGCAAAATTAATTT
CCTCATGTGGGGAAGGCATTATTTCAAGAGGTGGGGCTGAGGGTACTACTTCCTCAGGTGGGGCAAACCCTTGANAATCT
GAGGATTCAAAATTCTCAGCTTCAACATGGTCTTCCCACACATCCCCGTCCCATGTTGTANGATCCCATTCTTTGCCNAT
TANAGCCCTTACTTTAACTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16614738..16615162 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4760967..4761391 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22300397..22300821 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45782326..45782750 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18736092..18736516 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14981086..14981510 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16883511..16883935 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31823819..31824243 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17418037..17418461 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4663021..4663445 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32282639..32283063 411
 
EST/CDNA Est Name
  BY263328.1 - CF908402.1 - CK625672.1 - CJ048763.1 - BY740433.1 - BU504083.1 - BF161236.1 - BB614491.1 - BI100689.1 - BU149825.1 - BY335821.1 - BY329225.1 - BB862628.1 - BY227476.1 - BY155011.1 - BY253858.1 - BY172576.1 - BY170793.1 - BY005361.1 - BG971146
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16246860..16247284 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35329845..35330269 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45682988..45683412 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 62667993..62668417 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11075392..11075816 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13776911..13777335 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15696994..15697418 411
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14228777..14229201 411
 
EST/CDNA Est Name
  AV008224.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15515250..15515674 411
NO GENE  

 
Come back to gene AV008224.1


For any suggestions or comments, please send an email to unitrap@crg.es