Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-12G1
Clone ID FHCRC-GT-S21-12G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-12G1
Sequence
AATTTAGAAGCCGGAGGAAGCTCAGTCCTGGTGGTGAGAGAGAGGATGGGACTCCTGGACCCATCCCAGAAAGAGGTGCT
GAGATTCGCAGTAAACTGCCGCATCCTGACTCTAGTGCTACAGGTTCTCACGCGGTTTTTGGCCTCTTCCACTCCTATCA
TGTACTGGTTTCCAGCTCACCTGCTTCAGGATCAAGAACCGCTGCTGAGGTGTGTGGACACAGAGCCTGGGAAGCTTCCT
CAGGAGAAGCCCCCACCAGGACAGAAGGCCCCCAGAAACTGCCTCATGAAACTCTTCTACGATTGGAAGAGCTGCTCGCC
AGTCACAAGATGCGTTCTGGTCTACTTCCTGACCTACTGGCTTCTGGGACTAATTCTCCATTGCAACTTCCTGCCTTGGA
CTTGACCTGGAGTGTCAAGGGTTGAAAGCTCTAAGACGACACCCTGGCTGGGACAGCCCGCACACTCCGGAGAGCACTGT
GCAGTAGGATCTCTGGGTCTCTCTGGGGGCCAGCTAAGAAGGGAAAATGGGAGCACAGGCGCCCCTTCTCATCCTGGGCG
GGGCAGGTGTAGGGGAGTAACTTCAGTGCTCAGTGCAGGGGTCTCAGATCTCCCTAGTCCACAAGTACTAGGCAATCTTA
AACCTACTACTGATCCACGTGTAAGTCTGTCTTCTTGTTTTTTGAGAGAAGGTTGGTTTCTCTACATTGCCCTGATTTCC
AGGACATCCAGGGCTACGTAGTGAGGCCATGTCTCAAAACAAAACAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI8531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133215055..133225775 584
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es