Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-12D1
Clone ID FHCRC-GT-S21-12D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-12D1
Sequence
GTACAGAGAAGAGGAAACCCAGCCAGTGATAATGTGAGAATATGGAAGGCGATGGGAGCAGCTTGTTTAATGGGTAAAGA
AGAACCTTACTGTGGGAAACCTTATTAATCCTGTCAGGGGAGGGAGTAGCCATGACCAGTGTCTCAGTGATGTTCTGAAC
TTTCGGTAAAGTCTTGGGTAGCTTGAAGTTTATTGATGGAGAGACTGTGCTTGCCATCGCCTGTCAAGAATGATTAGCCA
CCCCCTATTCTCTGAACACTGCCAGCTGCTGTGATAAAGGCTCACCATGGAGGTCTTGTTCACTTTAGCACTGTGGTATT
CAAATAAAATTTCAAAAGTCCATAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47786902..47787245 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023984 (Usp49) NM_198421 ubiquitin specific peptidase 49 Gene [Source:MGI (curated);Acc:Usp49-001]

 
Come back to gene ENSMUSG00000023984


For any suggestions or comments, please send an email to unitrap@crg.es