Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14418H4
Clone ID IST14418H4
Vector VICTR74
Project tigm

Sequence tag IST14418H4BBF1
Sequence
CCTTGTCAGATAACACAGTACTGGCCACACACTGTGTCAACTGCCTGGAAGGCAAAGTCCAACAATGGATCTGGTCGGAG
TAAGATTAAGGAAATGGAAGACAGACTCAGAGGGACAGCAAACCCAACGAAGCAGTCACGGAGTCCTTAGTAGAGATAGA
GGCATTCCCGGACTCCACCAGTGACCGCCCTGGTGCTAAGAGAGTCTATCCATCTTCCCATGCTAGTGCAGTAGTGTGAT
ATCCTGCCCCTGNTGTGGGGGGGGATGGGGGATGGTNTCNTGTCNGANCNCNNCNNGGGGCATGANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104154386..104154690 285
NO GENE  


Sequence tag IST14418H4HMR1
Sequence
AAGGAACTGTCACATACACCCATAAAAAGCAGCACAAAAGACCTAGAAGTGTCTGAGCTGATAACCCGTCGGGTGGAGAG
CGTCTAAATTCACTTCCTGT
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104154687..104154786 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es