Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14233A3
Clone ID IST14233A3
Vector VICTR74
Project tigm

Sequence tag IST14233A3BBF1
Sequence
GCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCGCC
CTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGGCGCGGCGGGCGAGACG
GGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391488..57391690 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST14233A3HMR1
Sequence
GCGAAAGANTAATCGAACCNTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCTCCCGACG
TACGCAGTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATG
GGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCNAGTGCCTAGTGGGCCACTTTTGGTAAGCANAACTG
GCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105115000..105115281 250
 
EST/CDNA Est Name
  AA266239.1 - AA060712.1 - AA498684.1 - AA239708.1

 
Come back to gene AA266239.1 - AA060712.1 - AA498684.1 - AA239708.1


For any suggestions or comments, please send an email to unitrap@crg.es