Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13279G7
Clone ID IST13279G7
Vector VICTR74
Project tigm

Sequence tag IST13279G7BBF1
Sequence
AAGGCTTCANGATCTTCCTTAATTTCTTTCTTCAAAGATTTGAAGTTTTTATCATACAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI32986 UNI34363 UNI34364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20844373..20844428 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 70554663..70554718 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022707 (Gbe1) NP_083079 glucan (1,4-alpha-), branching enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1921435]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 39237836..39237891 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036095 (Dgkb) NM_178681 diacylglycerol kinase, beta Gene [Source:MGI Symbol;Acc:MGI:2442474]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 93333388..93333443 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 26224937..26224992 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5634703..5634758 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040473 (A330021E22Rik) NM_172447 RIKEN cDNA A330021E22 gene Gene [Source:MGI Symbol;Acc:MGI:2443778]

 
Come back to gene ENSMUSG00000040473


For any suggestions or comments, please send an email to unitrap@crg.es