Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S21-10F1
Clone ID FHCRC-GT-S21-10F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S21-10F1
Sequence
GGATCTTTTAACTGAGCCATAGGGTACTTGGAATCATGTTTCCCAGCCAAGATTGGCACTCCAAGGCAGCCATCCATCTG
TAGCCACTCCAGAGCCTGTTTGAAGATCAGAAAGAACATCTTTAATAACCCTGAGCATTCCTTGATGGGCCTAGAAGAGT
TTTCTCATGTTTGGATTTTGTTTGTTTTTCACAAAAATGGCCATTTGGACTACAAGGCAAAAGTGCAGCCGCCCAGGCTG
AATGGGGCAAAGACTGGAGTGTTCTCCACACGGAGCCCTCATCGCCCTAATGCCATAGGGCTGACGCTGGCCAAGCTGGA
GAAGGTGGAAGGTGGAGCTGTCTACCTGTCTGGAGTTGACATGATAGACGGCACACCTGTGCTAGACATAAAGCCCTACA
TTGCTGACTACGACTCACCACAGAACCTCAGTGTACACAATGACCACCATAAGCTGAGGGCTGAGGCCCAGGTTGATGGC
ACGGCCAACAGTTGTGACCAGCTGCTGCTCTCAGGGCGTGGGAAAGTACAGCCTCGCCAGAGCACCAAGGAGAGACCGAA
ATGCCTTGAAGACAGGACCTCAGGAGAAAACTCTCAGAAGTCCAGAGACATGTCAGAAATCCAGCACACTTTGCCAGAAG
ACAGAGAGAGAGCGTTGGATCTGGCACTGGAACCAAGCCGAGGTGAGAGCATGGATATGCCCGAAAATCAGCTTGGCCCA
CCGGAACTGAA
Sequence Type genomic DNA
Unitrap ID UNI14286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46395158..46400611 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028331 (5830415F09Rik) NM_029086 RIKEN cDNA 5830415F09 gene Gene [Source:MGI Symbol;Acc:MGI:1922003]

 
Come back to gene ENSMUSG00000028331


For any suggestions or comments, please send an email to unitrap@crg.es