Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11406F1
Clone ID IST11406F1
Vector VICTR76
Project tigm

Sequence tag IST11406F1HMF1
Sequence
ATACCATGATTGTTTATGAAAAGAATCTTTAATAAAGCTGGTTACAGTTANGCTTGGAAAAAAAAAATANAAAAANTAAN
TAATTAANTAAAAAATAAAAAAAANTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11406F1HMR1
Sequence
GTATTTCAGGCAGGACATGGGCAGACAATCAACAATATACAAGAACTTCCAAATTCCCTTCTTGTATAGACTACCAAAAT
CAGAAAGCCACTATAAAACCCAATGAAGTCTTCATTCAATGCTTTGAAAAGGGGGAAGTAGCTTAGAGTGAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI32346 UNI32250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 117745328..117745483 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056553 (Ptprn2) NM_011215 protein tyrosine phosphatase, receptor type, N polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:107418]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8288346..8288501 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133520709..133520864 156
 
EST/CDNA Est Name
  AI835647.1 - CA944278.1 - BG065528.2 - DY247849.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 46806444..46806599 156
 
EST/CDNA Est Name
  DY247849.1 - CA944278.1 - AI835647.1 - BG065528.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74828062..74828217 156
 
EST/CDNA Est Name
  AI835647.1 - CA944278.1 - BG065528.2 - DY247849.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22124803..22124958 156
 
EST/CDNA Est Name
  AI835647.1 - CA944278.1 - BG065528.2 - DY247849.1


Sequence tag IST11406F1BBF1
Sequence
ATACCATGATTGTTTATGAAAAGAATCTTTAATAAAGCTGGTTACAGTTAGGCTTGNAAAAAAAAAATAAAAAAAATAAN
TAANTAATTAAAAAATAAAAAAAATTAAANANNNGNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene AI835647.1 - CA944278.1 - BG065528.2 - DY247849.1


For any suggestions or comments, please send an email to unitrap@crg.es