Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13992F6
Clone ID IST13992F6
Vector VICTR74
Project tigm

Sequence tag IST13992F6HMF1
Sequence
ATAGTTGGATGTAGTACTACCACCACCTATAGTCCTAGCTACTTGGGTGCCTAAAATGAAAACCCTCAAGCCTAGAACTG
CAAGGCCAATGTGGACAGTATAGCTAGGCCCTTTTCAAAAACAAAACAAAGCAAAACAAAAGGTGAAGCCAAATGTAGTA
GTACTATAATCCCAGATTTCCAAAGGATTTCTCAAACAATTTTTGCTCTAGTTTTGCTTTATTTTGTTGAGAAAGGGTCT
CATGTNGCCAAGGCTGGCCTCAAACTCACTGTATACCCAAAAATGACATTGAAATACAGATCCNAGCTGAGCGTGGTGGC
GCACGCCTTTAATCCCAGTACTCGGCAGGCAGATTTCTGAGTTTGAGGCCAGCCTGGTCTACNNAGTGAGTTCCANGANA
GCNANGGCTNNNNAGANAAACCCTGTCTCNNANAC
Sequence Type genomic DNA
Unitrap ID UNI30727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7816636..7817064 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST13992F6BBF1
Sequence
ATAGTTGGANGTAGTACTACCACCANCTATANTCCTAGCTACTTGGGTGCCTAAAATGAAAACCCTCAAGCCTAGAACTG
CAAGGCCAATGTGGACAGTATAGCTAGGCCCTTTTCAAAAACAAAACAAAGCAAAACAAAAGGTGAAGCCAAATGTAGTA
GTACTATAATCCCAGATTTCCAAAGGATTTCTCAAACAATTTTTGCTCTAGTTTTGCTTTATTTTGTTGAGAAAGGGTCT
CATGTNGCCAAGGCTGGCCTCAAACTCACTGTATACCCAANAATGACATTGAAATACAGATCCNANCTGANCNTGGTGGC
GCACNCCTTTANNCCNANTACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es