Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14740E8
Clone ID IST14740E8
Vector VICTR76
Project tigm

Sequence tag IST14740E8HMF1
Sequence
TTTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTTCTGTTACAGGATCTGTCTCTCTTGCTATTTTTCTTTGT
GTTACTGTTGTTCTTAATTAAGGATCTAAGCGCTGTAACTGCAGTCCTTTTAGAATTGGAGGAAGACAAGACAGTCACTT
AGGCGGTAGCTGTTGGAACAGTCTAACTTCAGCTCAGCTCCTTTAGACCTGGAGCACAAGAGAAATTTTCACAGTTCCCT
GAAGCTTCCATCTACCTCAGCATGTCTCGTGGGCTGGAATATAATGTGGTGAGCCTATGACAGACACGGGGTTTGGTGAA
NACNNCAGTGTGAGGCACACAGCNCTGACACNNACTTGCAAGNANGTGACATGTGACNCANNTNCNNGTTTNNANNNTN
Sequence Type genomic DNA
Unitrap ID UNI23119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108250721..108251109 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]


Sequence tag IST14740E8HMR1
Sequence
ANAGAAGAGACGAGATGAGACGAGACACCNGGATCNNTGGCNCACACATAATCCCAGCACTCAGAAGGGTGAGGCAGGAG
TGTGAGTTGGGGGATAGCCGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108251111..108251210 92
NO GENE  

 
Come back to gene ENSMUSG00000013150


For any suggestions or comments, please send an email to unitrap@crg.es