Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15081D4
Clone ID IST15081D4
Vector VICTR80
Project tigm

Sequence tag IST15081D4BBF1
Sequence
CTGACATTAAGATGATATAAAAAGACTTGAAAATATTTACAGTGCTATAGACATAGACAAGCCATACAGAAAAGTTCATT
TCCAGAACAAATGAAGTCTTTTGGCAACATTTTATAATTCCTTCTAAAAGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62632480..62632616 137
NO GENE  


Sequence tag IST15081D4HMF2
Sequence
CTGACATTAAGATGATATAAAAAGACTTGAAAATATTTACAGTGCTATAGACATAGACAAGCCATACAGAAAAGTTCATT
TCCAGAACAAATGAAGTCTTTTGGCAACATTTTATAATTCCTTCTAAAAGAAGATCTAATGTTTAAATCTTCTGGGAAAC
CAGTATGTATATCCTATCACAAAGACACAGAGATGTCTCTTAATAAAAAATTAAAAGAAAATCTATAAATACAGTTACAG
TGGTAAATGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62632480..62632733 254
 
EST/CDNA Est Name
  CJ076227.1


Sequence tag IST15081D4HMR1
Sequence
CTTTNNGTNNNGAAATAGTAAAAGGTTTTACAAGGGAAAAATCCTATCCATGTAAATGACTTGGTAAAGACTGTAGACAT
CAGAGTTGTCTTCAATTTCAAGAGCAATACATCTTGTTTCAAAAACCAATCTTGTTTCATCTATTCTGCATCATAGCCTT
GAAGGAAGTAAATTATTTACCACATTCACTCAAGTGCTTTTGGGGAGATCACCAATGTGGTTGTTGAAACATTGGTAGTA
GATATTAACATTTGCTCTGTGTGTGACAAATCCATTCAGAGAGATTGTTTGGCTGTTCCCGTCTTCCTTCTGTGACTCCT
GTTCATCTTGGAATATGCTTTCACCTGGTGATAGGTAGCTTTCTGCAGCAATGTATAGAGTGGGACTCCTATCATCTAAG
TGCCTCACTGTTTATACNAATATCAGGCTGTGCTTAATCATACTTTTCAAGGNNNGCTGCTTGNTCGGANCAGTTTTNNN
TGGTNTTGTCATTCATATTTNCNCAN
Sequence Type genomic DNA
Unitrap ID UNI2143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62631986..62632479 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]

 
Come back to gene ENSMUSG00000074865


For any suggestions or comments, please send an email to unitrap@crg.es