Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14717G7
Clone ID IST14717G7
Vector VICTR76
Project tigm

Sequence tag IST14717G7HMR1
Sequence
AGGCAGAGGCAGGCGGACTTCTGAGTTCNAGGCCAGCCTGGTCTACAGAGG
Sequence Type genomic DNA
Unitrap ID UNI16449 UNI21533 UNI30967 UNI34369 UNI34370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 24250584..24250633 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026147 (Col9a1) NM_007740 collagen, type IX, alpha 1 Gene [Source:MGI (curated);Acc:Col9a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 63899758..63899807 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060843 (Ctnna3) NM_177612 catenin (cadherin associated protein), alpha 3 Gene [Source:MGI (curated);Acc:Ctnna3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86191047..86191096 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17544369..17544418 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 80069533..80069582 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27810465..27810514 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16929005..16929054 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29409718..29409767 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052712 (BC004004) NM_030561 Uncharacterized protein C6orf89 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q99KU6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42065013..42065062 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25034790..25034839 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142027307..142027356 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 20798222..20798271 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125003574..125003623 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029389 (Ddx55) NM_026409 DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 Gene [Source:MGI (curated);Acc:Ddx55-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115622064..115622113 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18798409..18798458 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039842 (Mcph1) NM_173189 microcephaly, primary autosomal recessive 1 Gene [Source:MGI (curated);Acc:Mcph1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66850051..66850100 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 159158073..159158122 48
NO GENE  


Sequence tag IST14717G7HMF1
Sequence
CAGCCAGTCTGAGACAAAGCCCCTGATTCTATAGGGAACTCCCAGTGAAGCTGGAGACTTTCCTGGAGACAGCTGAGGAG
CTGCCTCCTGTAGCGCGTATGGTCTTCCTCTCTAGCCCACCCTTACCTTGGAAGGGAGCTACTTCTGCTCTTCAGCCTAA
AACTGAAAAGTCAAACTTTGGGTGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21081924..21082113 190
NO GENE  

 
Come back to gene ENSMUSG00000039842


For any suggestions or comments, please send an email to unitrap@crg.es