Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S20-5G1
Clone ID FHCRC-GT-S20-5G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S20-5G1
Sequence
GAATGCACAATTTTGAGGAGGAGTTAACGTGTCCCATCTGTTACAGCATCTTTGAAGATCCCCGTGTACTACCATGCTCT
CATACATTTTGTAGAAACTGTTTGGAAAATGTTCTTCAGGCATCTGGTAACTTTTACATATGGAGGCCTCTGCGAATTCC
ACTCAAGTGTCCTAACTGCAGAAGTATTATTGAAATTGCTTCTACTGGCATAGAATCCTTACCTGTAAACTTTGCATTAC
GAGCAATTATTGAAAAGTACCAGCAAGAAGACCACCCAGATGTTGTCACCTGCCCTGAACACTACAGGCAACCATTAAAT
GTTTATTGTCTACTAGATAAGAAATTAGTTTGTGGCCATTGTCTTACTATAGGCCAACATCATGGCCATCCTATAGATGA
CCTTCAAAGTGCCTATCTGAAAGAAAAGGATACACCTCAGAAGTTGTTGAAACAGTTAACTGACACACATTGGACAGATA
TCACTCGCCTTATTGAAAAGCTTGAAGAACAGAAATGTCATTCTGAGAAAATAGTTCAAGGTGATAAGGAAGTTGTTCTC
CAGTATTTTAAGGAGCTAATTGATACATTAGAACAGAAAAAAAAGTATTTTTTGGCAGCTCTTTGTGATGTTGGCAAAAT
GATTAATCAAGAATACACTCCACAGATTCAAGGAATGAAGGAGATAAGGGAACAACAACTTGAATTAATGACAATAACGA
C
Sequence Type genomic DNA
Unitrap ID UNI4787

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68841209..68841928 720
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es