Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10844C2
Clone ID IST10844C2
Vector VICTR76
Project tigm

Sequence tag IST10844C2HMR1
Sequence
ATCTAGAATGTAGTGCTTTATGGCTGCAATGCTCTGAGACCATGAGAGTTTATGGCAGTCTGATAGCTGAGCTGTAATTC
ACACGATACATTGGGTCACTCAAGTCACTTCTCGTTATTTCAGTGTAGTTGCTGGTATGTGCCATTATCATAGTTGATTG
ATTCTAGAACATTCTCACCCTAATTTACATCTATCTCAATAGCCTGCAC
Sequence Type genomic DNA
Unitrap ID UNI6307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123195238..123195445 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]


Sequence tag IST10844C2HMF1
Sequence
GATCAAGAGTGGGTAAGTTGTTTTCTAGGCGCACTTGAGAGCTTTTGTGCCTCTTCCATGGGTCANAGGAAAACAAAGGC
TAAACCCTCCTCTTTTAAAAGGTCAGGGTCAGAGGTGCAGAGCCCACAGCCGGCTTCCTCGTAGCTGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123195091..123195240 148
NO GENE  

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es