Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S20-4H1
Clone ID FHCRC-GT-S20-4H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S20-4H1
Sequence
GGACTGTGCAGGATTTGATCGGGTAGACCTCCCTTGCTTGCTGCTCCCAGCTGCCTGGTCTTGAATACCATCATGGCCAA
ACCTTACGAATTTAACTGGCAGAAGGAAGTGCCCTCTTTCTTGCAAGAAGGAGCAGTTTTTGACAGATACGAAGAGGAAT
CTTTTGTGTTTGAGCCCAACTGCCTCTTCAAAGTAGATGAATTCGGCTTCTTCCTGACGTGGAAGAGTGAAGGCAAGGAA
GGACAAGTGCTAGAATGTTCCCTCATCAACAGTATTCGCCAAGCAGCCATACCAAAGGATCCCAAAATCCTGGCTGCTCT
CGAAGCTGTTGGAAAATCTGAAAATGATCTGGAAGGGCGGATATTGTGTGTCTGCAGCGGCACGGATCTGGTGAATATCG
GCTTCACTTACATGGTGGCTGAAAATCCAGAAGTAACTAAGGTAACATCTCAATGGCCTCCCTCCCCAATAAGTGTATGG
TGTGTGTGTGTGCGCCGCGCGCGCACAGTTGTTTAATGTTTAATATAATTTTAAATATGAAGTTGAGAATTGTACACGCA
TTTTAATCGTTTAAAAGTTCACTGCTCTGCTGGAATATTTCTGTAGAAAATTCAGCATCCCAAATGCTTTCATTACCCAT
CACACACAGAAGTCAGCCCTGCCTGGCATGATGTGTTTTCA
Sequence Type genomic DNA
Unitrap ID UNI14299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135631285..135736220 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es