Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15050F7
Clone ID IST15050F7
Vector VICTR80
Project tigm

Sequence tag IST15050F7HMR1
Sequence
GCCGAGCATTCTGCTTATGANCCNNTGGGAGCCACTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15050F7HMF1
Sequence
GGCCCAGGAATTTACAGAAATGAAATTTAGCTCCCAGTGAGAGGCCATTTTCCACTGTCAAATTGGA
Sequence Type genomic DNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100237653..100237718 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es