Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890G11
Clone ID IST10890G11
Vector VICTR76
Project tigm

Sequence tag IST10890G11HMR1
Sequence
NAGAACAGTCTGTTGTAAGGGCAGACAGGCATGGTGGCTCATGCCTAAAATCCCTGAATTGGAGAGTCCCAGTCAAGACG
ATAGAAAGTTCAAGGCCTGCCTGGGCTATAGAATCATTTCCAGGCCAGCCTGGGTAAGATAGTGAGATCCTCCCTATAGC
AAAATAAAACCCCTGGGGCTGTAGCTCGGTGGTGAGGTGCTTACCTAGCATCTGTAAGGAAGGCCTTANCTTAACTCCCC
CGCACTGAAAAATGCGCCCN
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72841335..72841592 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]


Sequence tag IST10890G11BBF1
Sequence
CTATTAAAAAACAAAACAAAACAAAAACAAACAAACAAAACCTCAGACCTATAATCCTAATTACTTGGAGTCTGAGACAA
GAGATGAATAGCTCCAACAACTAGGGTTGCATGCTGTCATANTCTGGCCTAGGATGTAACAAAAGGGAGGGGTGTCCTGG
AAAGATGGCATACTCTCANCTATCGCTCCAGAACTGTGCTCAGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72841130..72841336 203
 
EST/CDNA Est Name
  BE985840.1


Sequence tag IST10890G11HMF1
Sequence
TATTAAAAAACAAAACAAAACAAAAACAAACAAACAAAACCTCAGACCTATAATCCTAATTACTTGGAGTCTGANACAAG
AGATGAATAGCTCCAACAACTAGGGTTGCATGCTGTNATANTCTGGCCTANGATGTAACAAAAGGGAGGGGTGTCCTGGA
AAGATGGCATACTCTCANCTATCGCTCCANAACTGTGCTCAGGATCCTGCTTAATGCCNTGCTCCCNANCATAATATGAT
GTTCACGGTCANANCCNNTGGAACTGGAGTTNAAATAATTGGGAGCTGTCTTGTGGGTGCTGGGAATNAAACTTGGGTCC
TCTGGAAGAGCAACAAGTTCTGCTAACCNCAGAGCCNTCATCTNTCCAGCCCTNNATCTNTTNTATTGNGTTGGTNAGGG
TGTNTCTNNNNNNNNNGTAAATAAGACACATACNCNNCNCANNGGCCTGTGGTGGTGTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BE985840.1


For any suggestions or comments, please send an email to unitrap@crg.es