Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11142D6
Clone ID IST11142D6
Vector VICTR76
Project tigm

Sequence tag IST11142D6HMF2
Sequence
ATGATTACTCTTGTAATTATCTTAATTACAGTATACAGGTGAATTAAAGATCTTAAATTTGAAGTCAAACTGCAAGCTGC
AGTCAATGGAACAATAGCAGTTTTAACCATAATTTTTAAGTTTTTGTGCAAGGTTAGGATAATACCTGTAACCTTGGGAA
AGCAAANCCCANGTTTAAAACAATTTATTATCTTTAAAATCAATATTAGAAGCATTACTATCATATTACGAAGTTTGGAT
GTCAATTAATACCTATGAATACCTATTAAAGCANGCTTTAATGCTTTAATAAAGAGACATTGCTTTAAATCTTATTTNAA
ATTTTACTATTTANGATACGAACCACATTAATTATTACCTAANCTANAAATATCTTTAGAGACCNAGCCTCTTGGGCTGC
CTTATGCNNTGTGTCNGANGGACTCTAAACTTGAGTTATCNAATTTAACACTAACCATCTGTAGCAATGTAACAATTATT
AATCNNANCNNNCNACTTATGAGCTGANTGTGAAAACACTCAGNNNNCATTATNNNTAANAAAGAACNNNNTGAAGCAGT
TNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11142D6BBF1
Sequence
ATGATTACTCTTGTAATTATCTTANTTACAGTATACAGGTGAATTAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30509 UNI31035 UNI32321 UNI33728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166342: 220533..220585 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 33192..33244 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 255997..256049 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 167820..167872 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 822871..822923 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9893071..9893123 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24897147..24897199 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38835061..38835113 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9285419..9285471 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049152 (Ugt3a2) NM_144845 UDP glycosyltransferases 3 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:2145969]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3200320..3200372 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22841273..22841325 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6648771..6648823 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803508..7803560 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 44620327..44620379 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23580598..23580650 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222623..5222675 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3112493..3112545 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14346649..14346701 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3255522..3255574 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4167994..4168046 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52921219..52921271 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15920342..15920394 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14270897..14270949 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3792718..3792770 51
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es