Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11695H5
Clone ID IST11695H5
Vector VICTR76
Project tigm

Sequence tag IST11695H5BBF1
Sequence
TTGCCACTCAATAAAACATGAATNTATGGGGCCNAACCTATTCAAACCACTAAATTCCACTCCCTGGCCCGTATAGGCTT
ATAGCCATAACACAATGCAAAATGCATTTAGTCCAACTTCACAAGTCTGTCTATTGAANTGACAACAATGTTTAAAAGTT
CAAAGTTCAAAATCTCTTCTGAGATTCATGCAATCTCTTTACTGCANTTCCCTATAAAATCAAAAAGCANACAGCATATT
TCAAAANAATGGATATACATTACCATTTCAAAAATATCAANAGTTTGGAAATACTGGATCANAACAAGACCNAAAACCTG
CTGGGCAAACTCTCAACTCTGCATCTCCATCTGCATGTCCAATTCCTTTCANCTTTGTTAACTACNACACACTTTCTCCT
GGGCTGGTCCCACTCCTGTNAACAGTTTTTCTCANCANATATCCTATGGCTTTGGCATCTCGAACATCTTGGGGTCTCCA
ATGTAACTTCAACTTCACAGCTTCTTGTTCCAATGTCTGGNATTCATACATGANCTTTGTANCATGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507163..108507709 513
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST11695H5HMR1
Sequence
GCACTATTGGGTGGTATGGCCTTGTTGGAGGAAGTGTGTCATGGTGT
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507707..108507753 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST11695H5HMF1
Sequence
TTGCCACTCAATAAAACATGAATCTATGGGGCCNAACCTATTCAAACCACTAAATTCCACTCCCTGGCCCGTATAGGCTT
ATAGCCATAACACAATGCAAAATGCATTTAGTCCAACTTCACAAGTCTGTCTATTGAAGTGACAACAATGTTTAAAAGTT
CAAAGTTCAAAATCTCTTCTGAGATTCATGCAATCTCTTTACTGCANTTCCCTATAAAATCAAAAANCANACAGCATATT
TCAAAAGAATGGATATACATTACCATTTCAAAAATATCANGAGTTTGGAAATACTGGATCAAAACAAGACCNAAAACCTG
CTGGGCAAACTCTCAACTCTGCATCTCCATCTGCATGTCCAATTCCTTTCANCTTTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507329..108507709 367
NO GENE  

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es