Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S20-2F1
Clone ID FHCRC-GT-S20-2F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S20-2F1
Sequence
TGAAGGTAAAGAGCAAGAGAAGACCTTAGATGTCAAGTCCACTAAAGCTTCAGTAGCCGTACATTCCCCACAAAAAAGCA
CTAAAAATCATGCCTTGCTGGAGGCTGCAGGACCAAGTCATGTTGCGATCAATGCCATTTCTGCCAACATGGACTCCTTT
TCAAGTAGCAGGACAGCAACGCTTAAGAAACAGCCAAGCCACATGGAGGCTGCTCATTTTGGAGACCTAGATCCTGTCTG
GACTATCAGACTCAAGAGACCAAATCCAGTCTTTCAAAGACCCTTGAACAAGTCTTGCGTGACACTGTTGTCCTTCCATA
TTTCCTTCAGTTTATGGAACTTCGGAGAATGGAGCACCTGGTGAAATTTTGGTTAGAGGCTGAAAGTTTTCACTCTACAA
CGTGGTCCCGAATAAGAGCACACAGTCTAAACACAGTGAAACAGAGTTCACTGGCTGAGCCTGTCTCTCCATCTAAAAGA
CATGAGACTCCAGCATCTTCTGTAACTGAGGCTCTTGACAGGAGGTTGGGGGATTCTTGCTCAGCCCCACTGCTTGTGAC
TCAATCAGAAGGAACTGACCTGAGTAGTAGAACTCAGAACCCTCAGAACCACTTGCTGCTTTCCCAGGAAGGCCACAGTG
CCCGTTCTCTCCATCGTGAGGTGGCCAGAACAGGAAGTCATCAGATTCCCACCGACTCCCAGGACTCCTCCTCCAGACTT
G
Sequence Type genomic DNA
Unitrap ID UNI14307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61728589..61736328 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es