Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S20-2B1
Clone ID FHCRC-GT-S20-2B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S20-2B1
Sequence
GAGAAACAAACCCTCATCACCCACCAGTCTTGGATTGCATCAGCTCGCCTGGAAGAAGTCACTGGAAAGTTACAAGTAGC
TCGAAACCTTATTATGAAAGGGACAGAGATGTGCCCCAAGAGTGAAGATGTCTGGCTAGAAGCAGCTAGGTTACAGCCTG
GGGACACAGCCAAGGCTGTGGTGGCACAAGCTGTCCGTCATCTCCCGCAGTCTGTTAGGATTTACATCAGAGCAGCAGAG
CTAGAAACAGACATTCGAGCAAAGAAGCGTGTTCTTCGGAAAGCACTTGAGCATGTTCCAAACTCTGTTCGATTGTGGAA
AGCAGCTGTTGAGCTTGAAGAGCCTGAAGATGCTAGAATCATGCTGAGCCGAGCAGTAGAGTGCTGTCCCACCAGTGTAG
AGCTATGGCTTGCTTTGGCAAGACTAGAAACTTATGAAAATGCTCGCAAGGTCTTAAATAAAGCACGTGAGAACATTCCT
ACAGATCGGCACATCTGGATCACAGCTGCCAAACTGGAGGAGGCCAATGGGAACACTCAGATGGTGGAAAAGATCATTGA
CCGAGCCATCACCTCCCTACGGGCCAATGGTGTAGAGATCAACCGCGAACAGTGGATCCAGGATGCTGAGGAGTGTGACA
GGGCAGGGAGTGTGGCCACGTGCCAGGCTGTCATGCGTGCTGTAATCGGTATTGGGATTGAGGAGGAAGATC
Sequence Type genomic DNA
Unitrap ID UNI14308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181366674..181375387 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002455 (Prpf6) NM_133701 PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

 
Come back to gene ENSMUSG00000002455


For any suggestions or comments, please send an email to unitrap@crg.es