Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S19-7C1
Clone ID FHCRC-GT-S19-7C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S19-7C1
Sequence
GTTTGTAATATTATCTCTGCGGTTTTTGTCCTGCGGAATTGTTCACAAATACCCGATTCTGATCTTGGTCCATGTGAAAA
AATTCATGATGAAAATCTAAGAAAACAGTATGAGAAGAGTTCTCGCTTTATGAAAGTTGGCTATGAGAGAGATTTTTTGC
GATACTTACAGAGTTTACTTGCCGAGGTAGAGCGCAGAATTAGACGAGGTCATGCTCGTTTGGCATTATCTCAAAATCAG
CAGTCTTCTGGGGCTGCTGGTCCAACAGGCAAAAATGAANAAAAAATTCAGGTTCTGACAGACANAATTGATGTGCTTCT
ACAGCAGATTGAAGAGTTAGGATCTGAAGGAAAGGTAGAAGAAGCCCAGGGAATGATGAAATTGGTTGAACAGTTAAAGG
AAGAGAGAGAATTACTAAGATCTACAACCTCGACTATAGAAAGTTTTGCTGCCCAAGAAAAACAGATGGAAGTTTGTGAA
GTGTGTGGAGCCTTTTTGATAGTAGGAGACGCCCAGTCCCGAGTAGATGACCATCTGATGGGAAAGCAACACATGGGCTA
TGCCAAAATTAAAGCCACTGTGGAAGAATT
Sequence Type genomic DNA
Unitrap ID UNI4963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94159077..94171005 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]

 
Come back to gene ENSMUSG00000020863


For any suggestions or comments, please send an email to unitrap@crg.es