Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10922H2
Clone ID IST10922H2
Vector VICTR76
Project tigm

Sequence tag IST10922H2HMF1
Sequence
GTGGAAGGTAAAGTTCATGGGGGTGGTCCACGTGTCTAATTTGGGAACTGAGCTTACAAATTAGATCTTGAATCGGATAT
TGTGACACTGAGCAGTCACTTGCACGATCAAACGGGAGGCATCTAAATTGAGTCTTTAAAATTTTTATATTTGTATGGGA
AAAGACCGAGGCAGTGCTATTCTATTCTTGCGGTGGAATCGCTTTGCAAGANATGCACACATGTCTGGANCANACGGTGT
TTTTAACATAAGTTTCTTTACTGCATATTGTACTANGGCGTTCACAAATGTGCTAATGCAATAGGCANANGGTTTTCTTT
CTCCTTTGTATTCTCTATCCTTCCCTCCTCTCTCCCCTGTCCCTCCCTCCCTATTTCTTCTTCCTTCTCTTTCTCTCTTC
NCTGGGGATNAAAACAGGGCCTTGCAATTGCTAAACACGTGTCACCACAGAGTCNTCCCTTCAGTTCCCTCGGGCAAAGA
TCATTNNGCTTACAGCTAGAACACTTNNNNANTANTNNNNNATATTAATAATAAAAGTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10922H2BBF1
Sequence
GTGGAAGGTAAAGTTCATGGGGGTGGTCCACGTGTCTAATTTGGGAACTGANCTTACAAATTAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI27501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12401106..12401173 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]


Sequence tag IST10922H2HMR1
Sequence
CACTGANNTGTCCTGAATGGCGAAGCGGAGGATGATGGTCCAGATCATACCCAGGGTCATCTTCACATTGCCATCGACTA
TTTCTGTGGGCGAGAAAAACAAGCCGATGGGCAGATGACACAATCATGCACAACTCGCTGGCAAGGAGACGACTCGTCTG
TTTAAACAGGCACTGCTGAGCATCTGGCTGTGCGGCATCCATAAGCAAATGGCTCTGGTTTCTGTGAATTCTGCGTTAGT
GATAANTACCAGTCTCGCATATGCTTGGTCAATGCNNACCACCTCCGANTTCTGANACTCCNTCNNANGGAANGCATTAT
ATTCCCTGCCCTGGCCCCTCTTGCNNTCTTCTCNAAATGGCACTTGGNGACTNNNCNTGCANANTGACATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000052374


For any suggestions or comments, please send an email to unitrap@crg.es