Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14280A6
Clone ID IST14280A6
Vector VICTR74
Project tigm

Sequence tag IST14280A6BBF1
Sequence
TGTAGGCCAGGCTGGCCTTGAACAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14280A6HMF1
Sequence
TGTAGGCCAGGCTGGCCTTGAACAGAGATCTGCCTGCCTCTGCTTTCTGAATGCTGGGATTAAAGGCATACACCATTACC
ACTTGGTCACGTTTTTATTTCTTTTAACTTATATTTTTATTATTTGAAAATTTTATACATGTGCCCAGTGTACCTTGATT
GTATCTGCACGTTGCTCCCCACCTCTGATCCTCTTGGAACCTTCACCCCTATCTCCTTCCCAACCTTAATCTTTCCTTTT
TAAAAAAAAATTNNTGAATTTTTAACCTTCTACTGGGGCTGTCCATATGTGTATTGGTGTGANGTGGTGTGGGGACCCTA
CCNGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI13393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591561..45591889 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST14280A6HMR1
Sequence
TACAGAGTTGAGTTCCAGGGCAGTCAGGGCTACACAAAGAAAACTCACAACTCTCCATAATTCTAGCCCCAGGGGATCTG
ATACCTGCTCCTGGCCTCCACTAGGCACACATGTAGTTACACATGTAGGCATACCTGTAGGTAAAATACTTANACACATA
AAAAATGTTTTTAAAAAAATGAAGAGGAAATGCAGGGTGGGAAGAAGGGTATGGCACAAGCATAAAGACCTGAGGTCANA
TCCGCAGTTCTCATGCAAAAGCCAGGTGCANTGTATCCTCTGTAACCCCAAAACTCATCNNGCTGAGATGGGCAGATCCT
TANAGCTTGCTGGCCNNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591886..45592220 323
NO GENE  

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es