Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11582H10
Clone ID IST11582H10
Vector VICTR76
Project tigm

Sequence tag IST11582H10HMR1
Sequence
NTTCNATCTTCCTTCCNTTAGGAGGAGTCAAGGGGCATGGGTTTTCCCACATGTCTACNTGTCANCCCTGCACCAGCCTC
CGTCCCCTACGGCGCGCGATTTCTAACTACCGAGCGTTCGGGTCAGAGCCAGGGTTACGGGTTATCATCGTCGTCTCCCG
ACTACCATTANGCAAAAGAACTAANTGGTGGGGTTGCCCCTGTGGAAATGGGCAGTTTGTAACCAGGTCGTTGGTGCCTG
AAGTGGCACCCANGACGTGTTTGGTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI15265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36052922..36053189 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024436 (Mrps18b) NM_025878 mitochondrial ribosomal protein S18B Gene [Source:MGI Symbol;Acc:MGI:1914223]


Sequence tag IST11582H10HMF1
Sequence
CCACGGGGAGGTAGAGAAAACCCCTCCAACGTTTTACCTGANCTACATAGGAACTTCNTAAGAGTGTANGAACCAGCTTT
AGAAGCGTGTGCCGCAAGGGGGCANCCATCTTGACGCACACCGNACGTACGGCCTGCCGGAAGAGCGACTGCNCATGCTC
GGGACACGCACTAGGGTGGGCNNANGACACGCCCCGCAATGCGGAAGGCGGCTGCTCACATGTNTNANGGCGGAAGCGTN
NNGGGGCGGGGTCCACANACNCNAATTNAAACTGCNTNACNNTCNAACCNNCCTTCAAAATTGCATTTCTCCCNGNNCAN
TNNCNATGAATCCTANATTCNNTGGTTAGTGTCTAACATGAAAGCANNTTTGATTGCGATTNTNACCNNGGTGCTCCCAG
TGCGCATGCGTCGGGCCGTTTCNNCCNACCGANGGCGANCNCGGGTCGCCGGANCGGAAGTGGTGGAGGCAGANGAAANG
NNNGTGCCNGACGCNGCNATCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024436


For any suggestions or comments, please send an email to unitrap@crg.es