Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S19-4G1
Clone ID FHCRC-GT-S19-4G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S19-4G1
Sequence
GGTGCTGAGAGCATAACCACATACACCTTTAACACGCACAAAGCCCAGCACACCTTCTGCAAGAGATGTGGTGTCCAGAG
CTTCTATACTCCGCGCTCCAACCCCGGGGGCTTTGGAATCGCCCCCCACTGCCTGGACGAAGGCACTGTGCGGAGTGTGG
TCACTGAGGAGTTCAATGGCAGTGACTGGGAACGAGCCATGAAGGAGCACAAGACCATCAAGAACATGTCAAAGGAGTGA
GCAGGGCAGTAGCCCTGTAGGTTGCATGGGTGTGTGTCGCTGTGCAGGCCTGCCTGGGCTACCATCTCCACTCCCCATGT
CTCTGAGGTTCACTCCAGCCACCATTTCTTTAGGCAGCTCTGCCTTAACCCAGGTTTCGTGTAAGAAACTTAACCTTCTC
CCTTCCTACCAATTTTTGTGTGATCTTTTAGAAAATAAATATTTCTGACATTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62338451..62341108 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es