Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S19-4E1
Clone ID FHCRC-GT-S19-4E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S19-4E1
Sequence
GCTCAGGCCATCCAGGGGGCTCAGGCCCAGAGCCCAAAGCAACCAGCACAATAGCGTCCAACAGCTGGACCGCCAACAGC
AGCCCCGGGGAGGCCCGGGAAGATGGGTCCGAAGGCCTGGACAAGGGTCTGGACAACGATGCGGAGGGAGTGTGGAGCCC
GGACATCGAGCAGAGCTTTCAGGAGGCCCTGGCCATCTACCCGCCTTGCGGACGGCGCAAGATCATCCTGTCAGATGAGG
GCAAGATGTACGGTCGAAATGAGCTGATTGCCCGCTACATCAAGCTGAGGACTGGAAAAACCAGGACAAGAAAACAGGTA
GAGAGATGGCTCTGGTCCCCTGTCACACCACCAGTGGATACCTTGATGGATACCTTGGATGTAGGAAGCACAGTTTAGCT
CACAGGGCCTGTTCATCAGTCAGAAAGATGGGTATTTGGCTAGTTGGGCTGGGTAGTAAAACAGCCACCTCCAAACCCCA
CGTAGGTTTTATAACATGTATTATATATATAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28468782..28478545 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002249 (Tead3) NP_035696 TEA domain family member 3 Gene [Source:MGI Symbol;Acc:MGI:109241]

 
Come back to gene ENSMUSG00000002249


For any suggestions or comments, please send an email to unitrap@crg.es