Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14617D2
Clone ID IST14617D2
Vector VICTR74
Project tigm

Sequence tag IST14617D2BBF1
Sequence
GTAGCAAGCACGCTGAGAGGGGACCAGCCAATTCTCTCCGCTTGCAACTTTCAGAAGCACACTATCCATTGGGCTAGAAG
TCCGATTTCAGGATCAGGAAGAGTCAAGGAGTCCAGTAAATCGATGCTATCTCTATGGGTGTGTCCCACGTGCTCACCGC
CCCTCCACTGCACCTAAAGCATCGTTTTTTATTTCTTTTGCTTATGTGCATATGTGCATGTGTGGAGGCCTTCCTGATTG
TTCTCCACCTTTTATATGGAGGCCAGTCTTTGCTACCTGGAGCTCTGAATTTCAGGTAGTCTTGCTAGCCAGTCTGCTCG
GGGAATCCTCTGTCCCTTTCTTCTAGTTTTCTAAGCACTGGGATTACAGTCGGGCTGACACACCCACCCAGCGTTTTACA
TGGGTTCTAGAGATCCAAATCTCTGTCCTCTTGCTAGCAGANCACAATTTTTCCCTGCTGACCGTCTCCCCAGCCCTGAN
CATAGCTTTNNNGTGTGTTTCACAACTANGTCCNCAGNNCNCCCNNAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72253837..72254360 504
 
EST/CDNA Est Name
  BF582775.1 - CA945313.1 - CK030711.1 - BQ256887.1 - CJ069204.1 - CJ042056.1 - CJ089445.1 - CJ062906.1 - CJ056553.1 - CJ049531.1 - CO803031.1


Sequence tag IST14617D2HMR1
Sequence
GCTACCTGTTGCCATGCTGGACTCCCTTGTCTGCGCTTCCTCATTTCCCCTTCCCTGGAGTCTAATTTTGCCTTTGCTGC
CTCTGCCTGTAACCAACTAGTGTGCTGGCTTCCTACCTGCTGCCTTTGCTGATGTCATGCTTGTCANCAGANACACCTTT
TTATTTTCTGTATTCCCTCCTCACTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTA
Sequence Type genomic DNA
Unitrap ID UNI8511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72253613..72253841 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es