Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S19-3E1
Clone ID FHCRC-GT-S19-3E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S19-3E1
Sequence
GTGTATAGAAAAACTAACAACTGATAAAGATCCCAAGGAAGAGAAAGAAGATGATTCTGTCCTCCCTCAGGAAGTTTCCA
TTACTACAACTAGAGCTAGCCGGAGCTGGCGCAGTAGTAGCAGGACCTCTATCTCTCGCCTTCGAGACAGTGAGAATACT
CGGAGCTCTAGGTCCAAGACTGGCTCCTTGCAACTCGTCTGCAAGACAGAACCAATTACTGATCAACTTGATTATGATGT
TCCAGAAGAACATCAGTCTCCCGGTGGCATTAGTAGTGATGAGGAAGAGGAGGAGGAAGAAGAAATGTTAATCAGTGAAG
AGGAAATACCATTCAAAGATGACCCAAGAGATGAGACTTACAAGCCCCACCTTGAAAGGGAAACCCCAAAGCCACGGAGA
AAATCAGGGAAGGTGAAAGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI11605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12851436..12864778 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024695 (Zfp91) NM_053009 zinc finger protein 91 Gene [Source:MGI (curated);Acc:Zfp91-001]

 
Come back to gene ENSMUSG00000024695


For any suggestions or comments, please send an email to unitrap@crg.es