Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S19-3C1
Clone ID FHCRC-GT-S19-3C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S19-3C1
Sequence
ATAGTTTCAGCTGCGTCCTCGAAGAGTCGTTCCGGGAAAGATGATGCTAATTCAGACATTTTGGAACAAGACAAGTTCAA
CGTTACAGCAGAGGGGGACCATAGCACTGATGACAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30442514..30442635 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es