Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12098C8
Clone ID IST12098C8
Vector VICTR76
Project tigm

Sequence tag IST12098C8BBF1
Sequence
GGTTCTAGCCTGGAAAGGCATTTTGGAAACCTGGAAGAGAAGAGGGGCTAGGTGGCGAGAGAAAAGAATGTAGCCAAGAC
AGTTACTCTGATCAAGGCTCAAATTTTATTGTTGCGACACTAGTTATGAAGGAAGGGGGAGGGGACCCGATTCCCGCCGA
ATAATCTCGGGTCCAGTAGAAAGGTGCACGTGTGTGGCTCCTCAGGTTCCAGCAGTGGGCGTGGCAGAACGAATGAGCAG
GAAGCTCCACCCCGAGCAAGCAGGTTTCAGGCTGGGGGAGGGGAGACTACATCTCCTCCCTTTTATTAACAAAATTTTAA
AAAAAGANAAAGCTGGCCTGAGGGGGGAAAAATTATCTATGCTCAATAGTTCTGCCTGGAATCTAGGGCTAAAGAAAAAA
CTTGCTTCACTGGGATTCTTTAACTTTTCTTATGGTAAACTGTATCTGGCTTAANACTGTCCTTTCTAGTANACNNCTNA
CTGANANGCCTGGNNCTGTANGCTCTGACTTTATAATGCTNATNNNNACNTNNTAGGTAACTTTNNAGTTGANNTN
Sequence Type genomic DNA
Unitrap ID UNI32606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173787320..173787871 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038147 (Cd84) NM_013489 CD84 antigen Gene [Source:MGI Symbol;Acc:MGI:1336885]

 
Come back to gene ENSMUSG00000038147


For any suggestions or comments, please send an email to unitrap@crg.es