Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14376E4
Clone ID IST14376E4
Vector VICTR74
Project tigm

Sequence tag IST14376E4BBF1
Sequence
CTCCTTCCTCAGTGTCCACGTAGCTGAGAATTCAGGTGTGCAGCTTCATTCATTTCTTCCTTCCACTTTCTGTTTGTTCC
TCCATAATTGCTTTTTGTGGGGTGCTGGGGATGGAACCCATAACCCTAGTGCTTCACTGGGGGATTCTAGGCAGTGGCTC
TCCTCTGAGTCACATCCCCAGGCAGAGACAGTTCCAGGCCAGCTTCAGTTATAATTTAGTTAACAGTAAATATTATTANA
AGTNNANNNTTNCNGATAANGTTAATTAAATGATTACNNNNCCNNCTNACTAAAGCNCATTGTTTACATTATCNTTCNCA
CNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14376E4HMF1
Sequence
CTCCTTCCTCAGTGTCCACGTAGCTGAGAATTCAGGTGTGCAGCTTCATTCATTTCTTCCTTCCACTTTCTGTTTGTTCC
TCCATAATTGCTTTTTGTGGGGTGCTGGGGATGGAACCCATAACCCTAGTGCTTCACTGGGGGATTCTAGGCAGTGGCTC
TCCTCTGAGTCACATCCCCAGGCAGAGACAGTTCCAGGCCAGCTTCAGTTATAATTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI34379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87376760..87446668 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST14376E4HMR1
Sequence
GGAGANGGACTATTTCNNGAAGAGAGAGTACGTGCGCACGCGTATGCATGGGAGGGGGGAGGAGAAGAATTGGATGGATA
ATGCATAGATGANCANAGAAGGAAAAGAATGTAAAGAAAGAATTGCTTCAATAAACAAATGGATGAGAAGACACATATAG
AGTGGGGGTGTTTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87446665..87446839 165
 
EST/CDNA Est Name
  AV250147.1

 
Come back to gene AV250147.1


For any suggestions or comments, please send an email to unitrap@crg.es