Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14288E7
Clone ID IST14288E7
Vector VICTR74
Project tigm

Sequence tag IST14288E7HMF1
Sequence
GCAATAGCAGAGATCTAGTAAAATTCATTTTAAATACACACACACACACGCACCACAAAACTTATTTTTTGCTCTTTTGA
TTCATGTCACATCCAACCAGTGCAAAATGGTGTGGACATGAACCACCTCTCTCACCAACCAGTCAAACTGCNGTACACAC
AACCNAGGNNAAAAGAAATTCTCAGAGGGANGAGTAAATAACAAACAAATGAAGAATGANCTANCNTGGAAGAGAACAAA
ATCAACTCTGNGGGCTGAAGCTGCTGACCAGGAANGTCACCNAGAAGCTGAACNAAAACGCNNNGGCTCACAAACCCAGT
GACNTGTANAGCTTGACTTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14288E7HMR1
Sequence
TGCTAATCTTGTGCATAATCACAATGCCACATTCCATCTCTGGCTCCCAGTCTCTTCTCTCTTTAAGCAACATACAGCTT
TACTCATTATTTTCTTTGTTTGTCGTAATAACTGAGGATGATATAATTTTAATTATCCCCATTCTTACAGATGAGGAAAC
TGAGGCCCAGAGAGGTTAAGTGTATT
Sequence Type genomic DNA
Unitrap ID UNI30854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109046097..109046282 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es