Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10907C11
Clone ID IST10907C11
Vector VICTR76
Project tigm

Sequence tag IST10907C11HMR1
Sequence
TGTGGATGCCCCCTCCATGCACCCCTGCCCCTTTTCCAAAACAGGGCTTTTCANTGTN
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17242140..17242196 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


Sequence tag IST10907C11BBF1
Sequence
NACCCAATGAATATATTCATCTATAANAAACTCCTGCACCGGGCTGGTGAGATGGCTCANTGGGTAAGAGCACTGACTGC
TCTTCCGAAGGTCCTGAGTTCAAATTTCAGCAATCACATGGTGGCTCATAACCATCCGTAACGAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17241965..17242113 145
NO GENE  

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es