Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S18-7G1
Clone ID FHCRC-GT-S18-7G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S18-7G1
Sequence
TCAGGTACACCAGTCCATTCTGATCCCACCCTCTGAGCTGGAGACCAATCCTGCCTTGTGGCTTCTTGCTGTGAGTCAAT
ACAAAGTCCGGGATACCTTCTGTTCCTATTCGGTGATGGAGCTTTGCACGAAAGGGCTGGGCTCACAAACTGAGTCCCTC
AAGGCACGAGGCTTGGACTTGTCCCGGGTAAGAACCTGTGTGGTTGTGGCAGAAGAGCGTCCCCGAATCGCCCTTACACA
GTCTTTCTCAAAGCTCTTTAAGGACTTGGGTCTCCACCCACGAGCTGTTAGTACTTCATTTGGCTGCAGAGTGAACCTGG
CAATTTGCTTACAGGGGACATCAGGACCTGACCCCACCACTGTCTATGTTGACATGAGAGCCCTGAGACATGACAGAGTC
CGGTTGGTAGAAAGGGGATCTCCTCACAGCTTACCTCTGATGGAGTCTGGAAAAATACTTCCTGGGGTCCGGATCATTAT
TGCCAATCCAGAAACAAAAGGCCCACTGGGGGACTCCCACCTTGGAGAGATCTGGGTTCACAGTGCCCACAATGCCAGTG
GCTATTTTACCATTTATGGAGACGAATCTCTTCAGTCTGATCATTTCAACTCCCGGTTAAGTTTTGGAGACACCCAGACT
ATCTGGGCCCGAACTGGCTACCTGGGCTTTCTTCGGAGAACTGAGCTCACAGATGCAAATGGAGAGCGCCATGATGCCCT
CTATGTAG
Sequence Type genomic DNA
Unitrap ID UNI14337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9633975..9661406 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es