Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S18-7F1
Clone ID FHCRC-GT-S18-7F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S18-7F1
Sequence
TTTGTCCATACGTTCTCCAGAGTCACTGTCTGCTTAGCTTGTCCCTAGGAAAACTGACTTTACAGATGACGTGTTTATTA
AGTCCCGCCTGCCAAGAAGTATGATCTGAATGAACTTAACGCATACAAGGTTTTAAACGTGTTTAACCTAAGTTATCAGA
TGTCTACAGTAATTGGTAACCTAAGGGGCTCATGACGCCACAGGGGAGGGATGAGATGTGGGGACCTCAAATGCACTAAG
ATCCCATGACTGTATAATTATACGTATGAAATCATCCACGTGCTGGCAGCCCCTAAGGGAGCAAAAACCAGGGACTTTGC
CACCATGCTGCAGACGGCCAAATTCTCTCTCCGAGCTTTGAAGCATAGTATTCCTCATCTTGGGAACTGCATGCAGAAAC
AGAGTTACCGTAACGTCGCTGGTCCTTATTACAGTAGAGTAAGATTGAAAAAGTACCACCTAACCAAGTGTCTGCAGAAT
AAACCCAGGATAGCAGGATTAGCAAGAAACATCCCAAGTCGGAGCTTCTCGTGTAAGGATCTTCTGCCTATTAAGCCAGA
AAGTGAAAAGCCCATTTCTGAAAACATGGATGCATTTGAAAAAGTGAGAACAAGACTGGAAACACAGCCACAGGAAGAGT
ACGAAGTCGTCAATGCAGAGATTAAACATGGCGGCTTTGTTTATTATCAAGAAGGTTGCTGCTTGGTTCGTTCCAAAGAC
GAA
Sequence Type genomic DNA
Unitrap ID UNI14338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 85481316..85488215 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024127 (Prepl) NM_145984 prolyl endopeptidase-like Gene [Source:MGI Symbol;Acc:MGI:2441932]

 
Come back to gene ENSMUSG00000024127


For any suggestions or comments, please send an email to unitrap@crg.es