Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14224E1
Clone ID IST14224E1
Vector VICTR74
Project tigm

Sequence tag IST14224E1HMR1
Sequence
ATGCCCTTCTTTACCTTATTTATTTATCTATCTATCAGAGGCACAAGCCTCTCAGTGAGTCTGGAGCTGGCTGAGTCAGC
TGGACTGACTGACTGCTAATTCCTGGGTCCCACTTTCTTGGTGCTGGAGTTATAGGCACGCATCAGTACACTCAGCTTAT
TTCTTTTGTTCTTTTTTTTGTTTTGTTTTGTTTTTGTTTTTGTAATTTTTGTTTGTTTGAGACAGGGTTTCTCTGNNTAN
CCCTGGCTGCCCNANAACTCTTTCTGTANACCAGGCTGGCCTTGAACTCACANATCCN
Sequence Type genomic DNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140857705..140858001 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]


Sequence tag IST14224E1BBF1
Sequence
GGCATGACAGTGTGCACCTTTAATTCCAGCACTCAGGAGGCAGAAGCAGGTGGACCCCTGAATTTATGGTTAGCCTGGTC
TACATAGAGAGTTCCAGGCCAGCCAAGGTTACAAAATGTGACCCCATCTAAAACAAACAAAAAAGATGGAGACACCCAAC
AGTAACCTCTGTCCTCCATGAATGTGCACCCAGACACTCACAAGAGCATACACATAAACATTCAAGCATCTACACACACA
TGCAGGCACATTAAAACAACAACAAAGACAGAAAGAAGGCTGGGACATCACTCAGAATCAGAGCCCTTGCTTAGCACGCA
CAGTACAGTGTGTTCAATCGCTGGGACTTGGCTGGGGCTAGGGCTGGGGCTGAGGTTCGAGGTGGGGTGCTCATCTACCA
TGTATGANGCCTTTGTTTATTACCCAGTCCTTCNAAAGCCNNTATGATGGCNCATGCNTATACTTAATCTAAAATCAAAA
TAAAACNTGGATCTGANTCTCCNANANCTAANGCCATNATCTGCCTNNNAACACATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140857997..140858533 505
 
EST/CDNA Est Name
  BI645672.1 - BI102859.1 - BF533893.1 - BG869615.1 - BY741558.1 - BY751686.1 - BY721929.1 - BG086817.2 - BU516323.1 - BG086786.2 - BY728911.1 - BI250280.1 - BY722373.1 - BE531607.1 - BY244089.1 - CF168526.1 - BP766491.1 - CB232518.1 - BB862740.1 - AI156851

 
Come back to gene BI645672.1 - BI102859.1 - BF533893.1 - BG869615.1 - BY741558.1 - BY751686.1 - BY721929.1 - BG086817.2 - BU516323.1 - BG086786.2 - BY728911.1 - BI250280.1 - BY722373.1 - BE531607.1 - BY244089.1 - CF168526.1 - BP766491.1 - CB232518.1 - BB862740.1 - AI156851


For any suggestions or comments, please send an email to unitrap@crg.es