Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S18-3E1
Clone ID FHCRC-GT-S18-3E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S18-3E1
Sequence
GACCCTACTGTGGACATGAGTCGGTAATGCCCACTGAGGACTTCTGGGAGCCATGTCAGACGAATCCGCCTCAGGGAGCG
ATCCAGACCTGGACCCGGACGTGGAGCTGGAGGATGAGGAAGAGGAGGAGGAGGAGGAGGAGGTGGCAGTGGAGGAGCAT
GACAGGGATGACGAGGAAGGCCTGCTGGATGACACATCCCTGGAAGGCATGTGTGGCACTGAGCATGCCCAGCTGGGGGA
AGATGGGCAGCGGCCGCCGCGGTGCACTTCAACTACCTCATCTCAGTCTGAGCCTTCAGAGCAGCTTAGGCACCAAGGCA
AGATCCTAGCATCCGAGGACCCCAAAAAGAAGCGAGCTCAGAAGCCCTCTCACATGAGAAGAAACATACGACATGAAGTT
TAAAACAGATCAATAAACTATCAGCAACAACAGAAAACTCCCCATAAAACTGAGTCATCAAAAGAAAAAGAAAAAAAAGA
AAAAAGAAAAGAAAAAAACTGAGTCATCTTCTCCTTGGAATTCGATTTCAGATAGTTGGAGACTGACCCAAGAGTGGGGC
TTCTTCCGTGACCTAAAAGATAACTAAATATAACTTTCTTAACTTTCCAGATTCTCAACAGCCCTTCTTTCTGCCAAGTA
ACAGCTTGATCTATAAGGGGAAATAAATAACATCATTTTCCTGTTTCTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106624239..106656469 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es