Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051A6
Clone ID IST15051A6
Vector VICTR80
Project tigm

Sequence tag IST15051A6HMR1
Sequence
GAATACTTAAAGAATGGTGTTAAGGCTGAACAGGTTGTTCCTGCTTTTGAAAGAATCTCTTGATAATATTCCAGGGGGAG
AGCAAAGACCTGCTGTTCATCTTGACTGCTAAATACAATGCCTGTATCTTGGAGTATAAGCAGAGTGGCGAAAGCATTGA
CATCATTACAAGAGCCCATGGCAATGTCCAGGTGAGGTGGCTGCTTCAGGCTGATCAGTTTTTCCTGCAAGGACTGCTGT
CATGATGCAGTGATGAGCAGCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10682209..10682473 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024740 (Ddb1) NM_015735 damage specific DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1202384]


Sequence tag IST15051A6BBF1
Sequence
TTCTAAGCTTTTAAAGAATCTTCCAAGTTCTACTCGCCACACAGAGGAAATACTAAGCGAGCCTGTAACATGTACTAAGC
TCGCACAAGACCCTAAGGGGATGTACAAAAGGCCAGGACTGAGGCTGGTAAGCATCTAGGCCTTGCAATTTCAGCTCTCT
TTCTCTCTGCTCTACAAGCAAAGTCCTCTATAATTCACCTCATTCTATTCAAGATTTGAGAAGAGAATGAAATGTTTCTC
CTTCACCTATGTATGTGGAGAGAAAGTAATCTGTAGTAATAACAAGCAAAGCTACAATAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10681908..10682211 304
NO GENE  

 
Come back to gene ENSMUSG00000024740


For any suggestions or comments, please send an email to unitrap@crg.es