Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15000D12
Clone ID IST15000D12
Vector VICTR78
Project tigm

Sequence tag IST15000D12HMF1
Sequence
AGGTCAGTTTCTGGGAGGAAAATGGAGGAATTAGGAAAATTGACCTTTTTGAAAAATTCATTGAAGCCATCTTTCTGTGC
ACCACAGAACTGCTAGGACATCGTTAGCTCTTACAGGGAGACAGAGGGCTCAAGTGCCTTAACATCTCTGTGTTAATGTG
GAGTCTTTAAGAGTTGTGGCTGTAAGCATGCAGCATTGACAGACTGGTTAGGGAGAGCACAGCTGGGAACCCTGGGCAGA
AAGACAAGACAGATTCTCTGACAGTGCTTACTTTGACGGCCTTTGTGTTTTGCCNATCACAGTAATGANNACNNGTGANG
ATANCANNTC
Sequence Type genomic DNA
Unitrap ID UNI15611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54011440..54011765 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


Sequence tag IST15000D12HMR1
Sequence
TTCTGACCCNACAAAATTCATTTTCTCNACTANGNNNATACTTGAGATGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es