Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S18-2A1
Clone ID FHCRC-GT-S18-2A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S18-2A1
Sequence
ACTCAGAGAGGCTGAGTAAGATGAGCTCCCTCCTGGAACGGCTCCATGCAAAATTTAACCAGAACAGACCTTGGAGTGAA
ACCATTAAGCTTGTGCGTCAAGTAATGGAGAAGAGGGTCGTAATGAGTTCTGGAGGGCATCAGCATTTGGTCAGCTGTTT
GGAGACATTGCAGAAGGCTCTCAAAGTAACATCTTTGCCAGCAATGACTGATCGTTTGGAATCTATAGCCAGACAGAATG
GACTGGGCTCTCACCTCAGTGCCAGTGGCACTGAGTGTTACATCACGTCAGATATGTTCTATGTGGAAGTGCAGTTAGAT
CCTGCAGGACAGCTTTGTGATGTCAAAGTGGCTCACCATGGGGAGAATCCTGTGAGCTGTCCAGAGCTTGTACAGCAGTT
AAGGTAAGCAGATAACATTGATATATTTCTTGGCACTGACATTGGCATTGATAAAATCCTGTTTTCTGGAGGGAAAAAAA
AAA
Sequence Type genomic DNA
Unitrap ID UNI14342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98040352..98050602 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es