Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S18-12F1
Clone ID FHCRC-GT-S18-12F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S18-12F1
Sequence
TAGTGAACATCGGGAAGAAGCTCTACGAGGGTAAAACAAAAGAAGTCTATGAGTTGTTAGACACCCCAGGCAGAGTCCTC
CTGCAGTCCAAGGACCAGATCACAGCAGGGAATGCAGCTAGGAAGAACCACCTGGAAGGCAAAGCCGCCATCTCCAACAA
GATCACCAGCTGCATATTTCAGTTGTTACAGGAAGCTGGTATAAAAACTGCTTTCACCAAGAAATGCGGGGAGACTGCTT
TCATTGCACCCCAGTGTGAAATGATCCCCATTGAGTGGGTGTGCCGAAGAATAGCAACTGGGTCTTTCCTCAAAAGGAAC
CCTGGGGTACAGGAGGGGTACAAGTTCTATCCACCCAAAGTGGAGATGTTCTTCAAGGACGATGCCAATAATGATCCACA
GTGGTCTGAGGAGCAACTCATTGCTGCAAAATTCTGTTTTGCTGGCCTTGTTATAGGGCAGACTGAAGTGGACATCATGA
GTCATGCCACACAAGCTATTTTTGAAATTCTGGAGAAATCCTGGCTGCCCCAGGACTGTACGCTGGTTGATATGAAGATT
GAATTTGGTGTTGATGTAACCACCAAAGAGATTGTTCTTGCTGATGTCATTGATAATGATTCCTGGAGACTATGGCCATC
GGGAGATCGGAGCCAGCAGAAGGACAAACAGTCTTACCGTGATCTCAAA
Sequence Type genomic DNA
Unitrap ID UNI14346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77385571..77391469 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es