Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10701B3
Clone ID IST10701B3
Vector VICTR76
Project tigm

Sequence tag IST10701B3BBF1
Sequence
CCTTTAGCAGTGAGCTAGGAACAAGATGGCCCAGGGCTCAGCAGCATACCACACCCTGCCTGCTGCAGGGAGTAGAACAT
AGACAGTGACTTTACATGGAGGCTCTGCTCTGTGCAGCGCATGGGCTGCTGTGGTGCTCACTCACTTACTGCTGTAAGTC
AGTACAGATGTCAGTCACCTACAGTAAAGTGAGGCTGGTGTCAGCATACAGTTGTGTCTGACCTAGTGTTTCGGCCTANA
GTCCTCACAGGCTTCCTGCTACCTTAGCTGCCTCTTTAAAACTTGCAATTTAGAAGATTCTGTGTTTTCCCACTAGACCC
ATTTTTTTCNNCTTGCCCACCTCTGCTGTTCTCTAACACGGCGGAGCCAGCCAGTCCCATTCTCTGCAGTCTAGTGGCAT
ACAGCACCAGGCTCTCCAGCAGTAGGCTTTTTTCTAATACTCTGCTGGCTTTGGAACACTGCTCCCCATGANTGCCTCTC
GAGCCGCCCNAATTACAGCACTGTCAGANTTAGAAGGTGANGTCAGTGTCCCTTGTCTCGGANCCNGCACTN

Sequence Type genomic DNA
Unitrap ID UNI33313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11865940..11866490 533
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es