Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14702A12
Clone ID IST14702A12
Vector VICTR76
Project tigm

Sequence tag IST14702A12BBF1
Sequence
ATGCCAACACTGTCCCTGTGGGTGCTGGGACTCAGACTCAGGTCATCGTGTTTGTGAAGCACTGTACTCGTTGAGCACTC
TCCAGTCTCAGCACTTTCATCCTTACTTGTAGACGTGCACACAGCTATTTGGATATACCATGTGGCTGTTACTTTGAGAA
GTTGGCTATTTCAAGGAATTGATCCATTCGCCAGCATATCGTAACCCTCTAGATGGCATCGAGCCCTGAAGCGATGGGCC
CACCTTTCTCCCCACACTTGCCTTTCATGCTAAGGCCGTGTCTATTCAGGGGAATTGTTGGGTCTGAGCGTCTCAGCTCA
NGAAAGCGGCAGGAGTGGCTTCTGGAANGAAGAAAGAAGGCCCCGANGGAAATAAAGACTNANTGTGGGGNAGGGCTGGA
CTTTCCCACCTCCCTGGANNNAGGGCNGCAGAN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121222910..121223341 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14702A12HMF2
Sequence
CTGCATACTGTTTACTTCCAACACACAGTGGCACAAAATAAACATTTTCATCCAAAGAGGAAGATGGGGGCGCAATAAAG
AATGACTGAATCAAAGCTTGACCAAAACCCAGCAGGGAAAATATAAAATTCTATAGCTCCATGTGTGACCCCTGGGCCAT
GATGGAATGTTCTGAGCTTGAAAGGGCTTGGACAGAGCCAATGCTCCCCCTTCAGCACAGATAACCAGTCCCTTGGGCTA
GCTCTACTCCACTCCTGCAGGTTTCTTGGCTGACACTGGATTGTCCTGGCATCTCCACCACACAAGGGATCCATTTTCAC
AGCTTCATGTAGTGAGCTCTCAGGATCTCCTTGGCTAGACTCCAAACCCTGCCATGCACTCAACCTCCTGGAACCTTGGC
ATTCTCATAACCGTATACTCNNACCCTATCCCTACGTTAGTCTANTGTATGGATCCACGTGCTCTCNTTCANTATTGTTT
TANTATAAGTGCCTCTAAAGANTGAATTCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26793676..26794184 495
 
EST/CDNA Est Name
  AW107083.1 - BQ955715.1 - BE377537.1 - BI157915.1 - BY539907.1 - BG077339.2 - BY529813.1 - BG976807.1 - BQ287070.1 - BB662403.1 - BG144667.1 - AA190025.1 - AA003580.1 - AA032681.1 - CJ044622.1 - CK023139.1 - AA277014.1 - AA990433.1 - BB648477.1 - BY034252

 
Come back to gene AW107083.1 - BQ955715.1 - BE377537.1 - BI157915.1 - BY539907.1 - BG077339.2 - BY529813.1 - BG976807.1 - BQ287070.1 - BB662403.1 - BG144667.1 - AA190025.1 - AA003580.1 - AA032681.1 - CJ044622.1 - CK023139.1 - AA277014.1 - AA990433.1 - BB648477.1 - BY034252


For any suggestions or comments, please send an email to unitrap@crg.es