Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12859H2
Clone ID IST12859H2
Vector VICTR76
Project tigm

Sequence tag IST12859H2BBF1
Sequence
AGGACCTCAGCGCGGCCGGGAGCTGCGGGCGAGCCCCTCGTCCCTGCCCGCCGTGCTGTCGCCGAANAAACCGGGAACGT
TGGGAGGAGGGAGTCCCCCTGGGCCTCCCGCTCGATTCCAGCTCTCCGCGGATGGTGGGCGGTGTGCGGACTCTGCNCNC
TCTGCTTGGGCGCTCCTGTTTTCCCCGGANTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168591242..168591438 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


Sequence tag IST12859H2HMR1
Sequence
ANGANATTTTTGGACCNCACCTCTCAAGGAGAAATTAGGACCTGAGAACAGGGACTGAAATGAAACATTAAGGTTAATAT
ATGAAATGTGGCAGCCTCAGAGGAACTGGCAGCCCTTAGCCTATCTGGGCTTCATTTAACCAAGGGAACATGCTTAAAAA
AGCCCCGATAGACAAAATTAGGCAAAATGGATACTATGCAACAACACAGGTGAAATGGATATTATGTAACATAATGGTTC
CTATCATGGGAGCTACAGCTTTGAGATGAGTTTAAGAGGACNCCNTTCANCTTCATCTTTTTTTTTATGGTAAGTNGTCN
ATCNGGCATGCAAGGTANGGTANGTGTCTANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73484917..73485264 326
NO GENE  

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es