Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10345F8
Clone ID IST10345F8
Vector VICTR76
Project tigm

Sequence tag IST10345F8HMF1
Sequence
GGCTGACCTGGAACTCACTGTGTAGACCAGGCTGGCCTTGA
Sequence Type genomic DNA
Unitrap ID UNI8572 UNI32149 UNI33570 UNI34394 UNI34395

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4375960..4376000 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6148226..6148266 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4057115..4057155 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3939787..3939827 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9655681..9655721 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072663 (Spef2) NM_177123 sperm flagellar 2 Gene [Source:MGI Symbol;Acc:MGI:2443727]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18677799..18677839 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 19041807..19041847 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20074978..20075018 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 18211128..18211168 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 33018531..33018571 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021911 (Parg) NM_011960 poly (ADP-ribose) glycohydrolase Gene [Source:MGI Symbol;Acc:MGI:1347094]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9027829..9027869 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 35973520..35973560 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72859702..72859742 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6019007..6019047 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034690 (Nlrp4c) NP_113566 NLR family, pyrin domain containing 4C Gene [Source:MGI (curated);Acc:Nlrp4c-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9204700..9204740 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 36479422..36479462 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045083 (Lingo2) NM_175516 leucine rich repeat and Ig domain containing 2 Gene [Source:MGI (curated);Acc:Lingo2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 17438353..17438393 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39285367..39285407 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29210368..29210408 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 35046557..35046597 39
NO GENE  

 
Come back to gene ENSMUSG00000045083


For any suggestions or comments, please send an email to unitrap@crg.es