Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-9D1
Clone ID FHCRC-GT-S16-9D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-9D1
Sequence
TTGAGTGGTGATTTTATGCAATGGCTTCAGAGCCAAGCAAATAAGTTTGTGAACAGGTTTCATGAAGAGAGGCGGACCAA
GCTCAGCCTCCTCTTAGACAACGAGCGTTGGAAGCAGGCTGATGTTCCTGCAGAATTTCAGGATCTTGTTGATTCTATAG
CGGATGGAAAGATTGCTTTACCTGAAAAAAAGCCAGTGGGTATGTGTAGTTTGTCACACATGGTTCCTCCCACTGTATAT
TGATGACGATGAGGGCATACCTCTGTCCCACAGCCTACAGTCTACATTCTACATTATGCAAACAAAATAGGTTTTCGATT
AAAGTTATAGAGTGATTGCTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21206489..21207169 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es