Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14808A10
Clone ID IST14808A10
Vector VICTR76
Project tigm

Sequence tag IST14808A10HMF1
Sequence
GTTCTAGTATCCATGTTAAAAGCCAGACATGCTGGCACATGATTTTTTATTTTATATTCATTTATTTTACTTTATTTATT
TATTTTCTGGCCTCTTTCTCCACCCCCAACAAGATTTCTCTGTGTAGCCCTGGTTGTCCCAGACCTTAATAGACAAGATT
GGA
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154165555..154165716 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]


Sequence tag IST14808A10HMR1
Sequence
ANTANAACGGAANTCCTCNCACATGCATGGANAATCTTANTTATTTGCATGTGGTTGTACAAAAGCATCCAATGCTTCCC
TCCTTCTTGTGTGAAATAGAGGTAGGGTGATATACAGATCGTAAGCTATTCAAAACAGGGCTTCTTANTCCTGTGCAGTG
GTATACCCTAATGAAATATGGACAGGCCAGCTGGAGTCTGGAAACCNNGTGACCTTGAGAATAAAAACTCATAGCTAGGA
AACCTATCTCTGCCATCACAATCANCANTAAAGGACCCTCCANGTGTGCTCTCANGGAAAAGANAACTCAAATCTGACTG
AAGTCACTATATTTTGAGTGACTTCAATCCAACCTTCCCTATCATATTTGCTTTTNNAGATTTATTTATTTTATGTGTAT
GAAGTANGTGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154165717..154166147 399
 
EST/CDNA Est Name
  BB788239.1 - BY659288.1 - BB738210.1 - BB834332.1 - BY544012.1 - BY559565.1 - BB791328.1 - BB329807.1 - BB733529.1 - BB311779.1 - BB313784.1 - BB735652.1 - BB773411.1 - AI152002.1 - BB230821.1 - BB352498.1 - BB038133.1 - BB218147.1 - AA929787.1 - AI005862


Sequence tag IST14808A10BBF1
Sequence
GTTCTAGTATCCATGTTAAAAGCCAGACATGCTGGCACATGATTTTTTATTTTATATTCATTTATTTTACTTTATTTATT
TATTTTCTGGCCTCTTTCTCCACCCCCAACAAGATTTCTCTGTGTAGCCCTGGTTGTCCCAGACCTTAATAGACAAGATT
GGCCAGGAACTCAGAGATTTGCCTGCTTTTGCCTCTAAAGGCATAAGTTACACTGTTTGTTTGTTTATTTGTCTATCTTC
TTTTTGTTTTTTAATTTATTTTTGATACAGTATTTTTCTATGTAGCCCTAGCTGTCCTGGAACTTGATATGTANATAAGG
TTGGCCTTGAATTTGCAGAGGTCTACCTGCCTTTACCTGCCCCTCCCCCCTTCCTTTGCCTCCTTTTCAAGCTCTGGGGT
TAAAGGTATGAGCTGGCCTANCANACTGTTACTGCTTTTGGTTTGAGACCGGGTTTTCCTGACACAGGGTTTTCACTCTG
TANCCCTGGCCTGTAACTCACTATATANATCNNGCTGACCTCTAAGTCNCAGANNNGCCTTTTTCANCTTCCTGGCTGGG
CCNCCTCCTGGNNNNTGACTTTN
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154165135..154165716 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es