Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13253F7
Clone ID IST13253F7
Vector VICTR74
Project tigm

Sequence tag IST13253F7BBF1
Sequence
TTATTTAGAAATTATCCATAAGTTCTGTGACTCTANAGAACCCTGACTAATACAGAAGTTGGTNCCAGGAGTGGTTCTAG
AGTAACANAAGTACAAGGATGAATCTTTTAAAATTCTGGAATN
Sequence Type genomic DNA
Unitrap ID UNI2131 UNI22305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9923563..9923683 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11333886..11334006 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96389332..96389452 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84966383..84966503 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32962745..32962865 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44028263..44028383 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 50015681..50015801 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24482984..24483104 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 18231831..18231951 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8421231..8421351 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33841735..33841855 115
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 68756248..68756368 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027035 (Lass6) NM_172856 LAG1 homolog, ceramide synthase 6 Gene [Source:MGI (curated);Acc:Lass6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 82423566..82423686 115
NO GENE  


Sequence tag IST13253F7HMF1
Sequence
TTATTTAGAAATTATCCATAAGTTCTGTGACTCTAGAGAACCCTGACTAATACAGAAGTTGGTACCAGGAGTGGTTCTAG
AGTAACAGAAGTACAAGGATGAATCTTTTAAAATTCTGGAATTGGCTTGTTGATCCACCAGCACTTTCNACTATTGAAAC
CTCTCCNNNTTCTCTCCCTCCTGGNANCTCANAGAATTTTGAANACCCNTGGTTGAAACNATNTTCCGAACTTAAAGAAG
CTAATGCCCTTGATTTTCTTANTGAATTANGTGATTCNGTGCACNNNGCNNTCTACAANANGGGGAANAANTCGANNANT
GATTTTACTGNCTGGNTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027035


For any suggestions or comments, please send an email to unitrap@crg.es