Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-7A1
Clone ID FHCRC-GT-S16-7A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-7A1
Sequence
TATGCCAGCACTGAGGTGGACGGGGAGCATTACATGACTCCAGAAGACTTCGTTCAACGCTATCTTGGCCTGTACAACGA
TCCAAACAGCAACCCAAAGATTGTGCAGCTCTTGGCAGGAGTAGCTGATCAAACCAAGGATGGGTTGATCTCCTATCAAG
AGTTTTTGGCATTTGAATCTGTTCTATGTGCTCCAGATTCCATGTTCATAGTGGCTTTCCAACTGTTTGACAAGAGCGGA
AATGGAGAGGTGACATTTGATGGCCTGAGCCTTGTGGAGCCCGTTGCATGTGCTGGATACAGTGTCCATGTGCCGTGTCT
CACTGTTACCCACTAGTGTCCTGGTATCCTGCTGGGTAGAATTAGGTAGCGGTAACCTGATCCCTGTCAAGTGGTAATAC
TGCATCCTGCTGTCATATGTTGCCTTGCATTGATCTTAAAAACTTTTAAAGAAGGTATTTATTGCTCTAACACAGATTGG
ATTCTAAAATCAATGAACATAATCAGAAGAAACTCTTACTTGTTTACTAATAAACATATATAAAACATGCAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71167797..71182089 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es